tdejuan88 tdejuan88

20-11-2020
Mathematics

contestada

Round 598,500 to the nearest thousand

Respuesta :

ping08kevin ping08kevin

20-11-2020

Answer: 599,000

Step-by-step explanation: 1-4 will always stay at the bottom and 5-9 will be at the top.

Answer Link

clayton1halofan clayton1halofan

20-11-2020

Answer:

599,000

Step-by-step explanation:

Answer Link

Otras preguntas

What is the image of (5,0) after a dilation by a scale factor of 3 centered at the origin?

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

How many solutions does the equation 4x+4-5x= -x+3 have?

Topic: Importance and impact of sugarWhat are the main ideas? What do I know about this topic? (at least 7 descriptions) *AP WORLD HISTORY*

Describe how you could conduct an experiment to quantify photosynthesis under different conditions, such as different amounts of sunlight.

AMAZING PEOPLE OF THIS UNIVERSE THAT I LOVE WITH THE HEART THAT BEATS INSIDE ME, I NEED HELP! PLS! my Home Work was to write a short story on either romance, f

high reward arithmetic sequence is -3 and the fifteenth term is 53. Find the common difference of the sequence. What is the 32nd term of the arithmetic sequence

6. How does this document explain how Islam spread so quickly?

Describe the relationship 18What is a lever? On which principle does it work?Is velocity ratio of a machine affected by applying

plzzz help answer tyhese