figueroamelany316 figueroamelany316

19-12-2020
Biology

contestada

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Respuesta :

raduoprea160 raduoprea160

19-12-2020

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer Link

Otras preguntas

According to Renaissance philosophy, commoners often represent A. appetite. B. love. C. reason. D. pride.

Tanya, Will, and Juan are playing a game. Juan scores 101,473 points. Tanya scores 9,879 fewer point than Juan. Will scores 9,853 more points than Tanya. What i

During which decade did transcontinental rail service begin in the United States?

Why is 4,325 greater than 798

When the states ratified the articles they agreed to obey the articles and all,acts of congress.a)did the states honor their agreement?b)how do you know

you have $550 in a savings account that earns 3% simple interest each year . how much will be in your account in 10 years?

much of flamenco music is an expression of oppression and

You find a job that pays $11.25 per hour. You plan to work 40 hour week. what will your weekly gross be

estimate. then record the product. 32×8

. What is the value of r? 0.2(6r − 5) = 8 A. 3.2 B. 7.5 C. 10.8 D 12.4