Seudónimo Seudónimo
  • 16-03-2017
  • Mathematics
contestada

can you help me on B and C! plz help me

can you help me on B and C plz help me class=

Respuesta :

Avocado4
Avocado4 Avocado4
  • 17-03-2017
B is 4 times 3 is twelve so the equation would be shape number times 3 equals the number of toothpicks. C is you could write it as number of toothpicks divided by 3 equals the shape number. I'm not sure tho
Answer Link

Otras preguntas

Solve the following inequalities a) algebraically AND b) graphically. 19) X2 - X - 6 > 0 20) x2-2x - 5 > 3 21) x2 - 4x < 0
4 3/4 - 2 3/8 thanks
A squirrel burrowed 4 holes in 6 minutes. How many holes could the squirrel burrow in 9 minutes?
Someone please help me!!
The slope line that passes through -3/5 and 4,1
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC
The level of a pond receded at the rate of 4 centimeters per day. Find the change in the water level of the pond after 7 days.
-6(w - 4) + 8W=6(w + 2)​
For a concentration cell, the standard cell potential is always:________. a. positive b. negative c. zero d. need more information
Using one complete sentence give a mathmatical definition of zero