DezdreadZ DezdreadZ

19-02-2022
Mathematics

contestada

solve for the correlation coefficient, evrything is in the image

solve for the correlation coefficient evrything is in the image class=

Respuesta :

tkpolk06 tkpolk06

19-02-2022

Answer:

The value of R is -0.5212

This is a moderate negative correlation, which means there is a tendency for high X variable scores to go with low Y variable scores (and vice versa).

Step-by-step explanation:

Ver imagen tkpolk06

Answer Link

Otras preguntas

Does the shape below show a correct line of symmetry? Explain

LAST QUESTION WILL GIVE BRAINLIEST TO CORRECT ANSWER Sponges, like the one pictured, demonstrate ________ symmetry. A. bilateral B. radial C. unilateral D. no

What’s the answer ??? (ONLY ANSWER IF YOU KNOW)

Blake mows a half acre of lawn for his grandparents every two weeks. If Blake has already mowed three-fifths of the lawn, how many more square feet must he mow

2 3/4,1 1/2 and3 3/8 in decimals, how many total miles did the person hike?

A sound wave is passing by a student 250 times every second. What is the frequency of the sound wave? 25 s 1 second 250 Hz 1/250 Hz

Dymesha watches her older sister do headstands. dymesha falls over when she attempts to do a headstand herself. she watches her older sister more carefully, and

which term identifies a type of chemical reaction a. decomposition b. distillation c. sublimation or d. vaporization?

you have a piggy bank containing a total of 93 coins in dimes and quarters. If the piggy bank contains $14.85, how many dimes are there in piggy bank

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’