gslovestodance2713 gslovestodance2713

18-11-2021
Arts

contestada

Why did ashley get kicked off spies lies and allies?

Respuesta :

officialkoketsu officialkoketsu

18-11-2021

Answer:

for a rule break during the 14th episode.

Explanation:

Answer Link

Otras preguntas

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

B is the midpoint of AC, D is the midpoint of CE, and AE = 23. Find BD.

A door opening is 2 m that if there is a 39 cm gap between the top of Casey say it in the top of the door open and how tall is Casey's blank centimeters

"But, soft! what light through yonder window breaks? It is the east, and Juliet is the sun." -from Shakespeare's "Romeo and Juliet" What type of figurative lang

The conjunction that shows a condition relationship is ____? A:if B:until C:as D:while

Which of the following features is common to both DNA replication and transcription? a) Deoxyribonucleotides are incorporated into the growing sequence b) B

What caused the revival of native arts in new mexico in the 1920s

The Earth's crust is divided into how many major plates? 15 25 3 7

Samuel Adams agreed with and supported the English Stamp Act. True False

Brenda won 121 lollipops playing horseshoe at the county fair. At school she gave 4 to each of her friends. She only had 9 remaining. How many friends does she