andrewcollis1221003 andrewcollis1221003
  • 17-09-2021
  • History
contestada

Businesses want more

Businesses want more class=

Respuesta :

govdylan1
govdylan1 govdylan1
  • 17-09-2021

Answer:

Demand.

It should be Demand. Please check.

Answer Link

Otras preguntas

The blizzard of 1971, which dropped more than twice ASAP! Oklahoma's average seasonal snowfall, impacted A. a small area in the northwest and the Panhandle B. O
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC
A quiz consists of 15 multiple choice questions, each with five possible answers, only one of which is correct. If a student guesses on each question, what is t
Which sentence from the passage shows Kane's uncertainty about the effect of his band's music?
Plz help me I just started 8th grade.
Tia uses natural processes to manage crop production on her farmland. She avoids the use of fertilizers for producing crops. Which alternative agriculture strat
0.07 is 10 times as great as ? A.0.1 B.0.7 C.0.001 D.0.007
3x+1=43 but you have to regroup/ divide the number next to x
All true stamens first a rhombus
The uncertainty in position of a proton confined to the nucleus of an atom is roughly the diameter of the nucleus. If this diameter is d = 7.8×10−15 m, what is