teshaunalovett teshaunalovett

16-12-2016
Biology

contestada

which method is often used in the disposal of medical waste

Respuesta :

JoshMDay JoshMDay

16-12-2016

Usually if we are talking about needles and body fluids, They are usually put into a box that is labeled hazard! And they dispose of the materials in a special trash can! :) Hope this helps!

Answer Link

thayward17 thayward17

03-09-2019

Answer:

Incineration (gradpoint)

Explanation:

hope this helps ;)

Answer Link

Otras preguntas

One of the events at the circus starred Gabriella the Human Cannonball. On Saturday she performed in four shows. Shot from a cannon, her distances measured 9.03

Ten percent of cereal boxes have a prize. A student wants to estimate the probability that when 8 boxes are purchased, fewer than 3 have a prize. To do this, th

Which sentence best describes the difference between the statement?

The index of refraction is based on the ratio of the speed of light in?

What is the muscle focus for this side stretch

These ones are tricky for me. Can anyone help? Twice the sum of 4 and 2a

7.4z−5(−1.6z+2.4) simplify

In conducting research for a report, Ashley made connections between ideas from multiple sources to create or support a single, main idea. What is this practice

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

Please I need help with English