1462632 1462632

18-03-2021
Mathematics

contestada

ill mark brainlist plss help

ill mark brainlist plss help class=

Respuesta :

18-03-2021

Answer:

C. 99 yd^2

Step-by-step explanation:

The formula for solving for area of a triangle is 1/2*b*h.

18*11=198

198/2=99

Answer Link

Otras preguntas

Identify the correctly written chemical reaction. A. Reactant + Product → Reactant + Product B. Product + Product → Reactant + Reactant C. Reactant + Reactant =

Read through President Water's letter and the Sand Dunes: More Than Giant Heaps of Sand article. Complete the background questions and then plan your work in th

What is machismo? A. a political party B. some funny game C. the male attitude of proving one's manliness or superiority D. a musical instrument

Grant’s first research question is “What happened in Jason’s early life?” What should his second research question be, and what would be the most credible sourc

Have you ever visited any grocery shop?

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (59)CTTAACACCCCTGACTTCGCGCCGTCG(39) (a) What

John's father specifically asked him to get a magnetic disk from the store in his neighborhood. What should John buy? A. a floppy disk B. a DVD C. a CD-ROM D. a

The chances of winning the Maryland lottery are one chance in twenty-two million. The probability would be considered an example of:_______

Did it matter that the wheel disappeared in the Middle East?

Swifty Corporation sells one product and uses a perpetual inventory system. The beginning inventory consisted of 76 units that cost $22 per unit. During the cur