4804378780 4804378780
  • 18-02-2021
  • Biology
contestada

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Respuesta :

malakmohammed0101 malakmohammed0101
  • 18-02-2021
CUGCUACAUCGUAGCUGGUAAC
Answer Link

Otras preguntas

Suppose that E and F are points on the number line. If EF=9 and E lies at 4, where could F be located? If there are several locations, separate them with commas
Which of the following is an equivalent trig ratio for tan 28 Cos 62 1/ tan 62 1/ tan152 Cos 28
help PLEASE HEPP ME PLEASE
Si un camión recorre 15 millas por galón de gasolina, con una eficiencia de su motor del 50%¿que distancia, expresada en kilómetros, puede viajar con un consumo
Can I pls get help on this ASAP!!
Military radar and missile detection systems are designed to warn a country of an enemy attack. A reliability question is whether a detection system will be abl
Copper sulfate is made of one copper (Cu) atom, one sulfur (S) atom, and four oxygen (O) atoms. Write the chemical formula correctly.
“She loved him nonetheless. He brought her treasures from traps. He told her stories of strange creatures he’d seen in the salt marches.” Which of the following
If a 2.0Ω resistor and a 4.0Ω resistor are connected with a 12 volt battery, what is the total resistance of the circuit? 4.8Ω 9.2Ω 6.0Ω 1.3Ω
All of the following things occurred as a result of the downfall of the Articles of Confederation, EXCEPT which one?