penelopetorresjcool penelopetorresjcool

16-12-2020
Mathematics

contestada

someone pls help me !!!!!! rn pls plsplsspsl

someone pls help me rn pls plsplsspsl class=

Respuesta :

grasielamarquezgonza grasielamarquezgonza

16-12-2020

Answer:B

Step-by-step explanation:

Answer Link

Otras preguntas

One saturday, clayton was sitting at home when the telephone rang. a local company was making promotional calls and told clayton he had just won a $500 gift cer

Compared to a federal system, constituent states of a country under a confederal system would be more likely to be able to do which of the selections listed bel

If two chords are perpendicular to each other and one chord is bisected, what do you know about the other chord? It is the radius. It is the diameter. The chord

The government might enact a price ceiling in order to accomplish what

Which example displays a challenge the US faced on the Pacific front of WWII? difficulty preserving food for troops due to harsh climate leading to spoiled food

An ostrich can run 5 mph faster than a giraffe. an ostrich can run 5 mi in the same time that a giraffe can run 4 mi. find the speed of each animal.

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

The authority of the new provisional government was soon challenged by the __________________ , councils of representatives from the workers and _____________

What should spectators should do to promote social cohesion?

Food was so scarce in the jamestown colony that _______ out of every ten settlers died.