jazminecsavoy jazminecsavoy

19-11-2020
Mathematics

contestada

what is the average speed of 600 meters and 40 seconds

Respuesta :

ricchad ricchad

19-11-2020

Answer:

15 meters per second

Step-by-step explanation:

aver speed = distance / time

= 600 meters

40 seconds

= 15 meters per second

Answer Link

Otras preguntas

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

What dose a correlated age mean

During osmosis do water molecules move from hypotonic areas to hypertonic areas or the other way around. explain

Where does most of the evaporation happening within the water cycle occur?

A line passes through the point (–7, 5) and has a slope of one half. Which is another point that the line passes through? (–13, 9) (–9, 13) (9, 13) (13, 9)

How do you say "you are doing it wrong you need to turn it" in german?

Oils are part of healthy eating styles because they provide nutrients for the body, like fatty acids and vitamin E. False True

Which is an equation in point-slope form for the given point and slope? Point: (1, –7); Slope: -2/3

Which of these shows historical bias? (4 points) A letter from a general ordering supplies for his soldiers A document praising the favored warrior of the king

in a particular class of 23 students, 18 are men. what fraction of the students in the class are men?k