aspr0530 aspr0530

20-10-2020
Biology

contestada

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Respuesta :

cryork2015 cryork2015

20-10-2020

GTTCAAGCTACTGTTCAAGCTACT

Answer Link

Otras preguntas

What philosophy are is associated with individualism and reliance on nature?

What is the volume of a 5M solution with that has 16.5 moles?

what the GCF to 100 and 16

How does family play a role in shaping our values and beliefs? Must be a paragraph long

what's the equivalent fraction of 2/9

PieSit6. When you climb a flight of stairs, you are moving your body weight (aforce) up a certain distance (the vertical height from the bottom to thetop stair)

what is the y-intercept i’d the equation 2y+5x=-14

2. How did technology affect the growth of slavery in the 1800s?

Most Countries use the ___________ structure for their legislative body. A. Legislature B. Congressional C. legislative body D. Parliamentary

A cactus casts a shadow 33 feet long. At the same time of day,Liam,who is 6 feet tall,casts a shadow 9 feet long,as shown. What is the high of cactus to the nea