hanwetz15 hanwetz15
  • 19-10-2020
  • Biology
contestada

More than what percent of your body is water

Respuesta :

mlemhdhsjs
mlemhdhsjs mlemhdhsjs
  • 19-10-2020
your answer should be 60%!
Answer Link

Otras preguntas

Paramecia use cilia to push food into a gullet. Volvox is photosynthetic and makes its food. How does an amoeba take in food
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
Questions 1-2! I really need help. I will name you the brainliest and thank you but just please help me and answer the questions!
how many delegates did the articles of confederation give congress?
All of the following are changes brought about by the geological process except
What is 13 1/3% in a fraction (simplest form) ??
Find a solution to the following system of equations. −5x + y = −5 −4x + 2y = 2 A- (2, 5) B- (–8, –15) C- (–2, –15) D- (0, 1)
How do the villagers react to Rip Van Winkle when he first returns to town after disappearing for 20 years?
how did nationalism lead to the creation of new countries in europe
A battery produces ________current, which is current that flows in only one direction.