annajcook2007 annajcook2007

21-03-2020
Mathematics

contestada

You roll a 6-sided die.

What is P(odd)?

Respuesta :

4801793976 4801793976

21-03-2020

Answer:

1/2 or 0.5

Step-by-step explanation:

There are six numbers on a die (1, 2, 3, 4, 5, 6), and three of those are odd numbers. 3/6=1/2=0.5

Answer Link

Otras preguntas

Revising involves a. Checking for spelling errors b. Checking for punctuation errors c. Checking for content clarity and coherency d. Checking the page limit

The role of a watershed is to _____. A. purify water. B. act as a drainage area. C. collect fish from rivers and streams. D. protect wetland areas.

In what ways did both nativists and the immigrants themselves contribute to any of these problems

What did John Adams and Alexander Hamilton agree on? Question 1 options: A) Neither thought democracy was a good idea. They both thought that the educated and

number of possible roots in x^4-14x^2+45=0

The point at which all three altitudes of a triangle intersect is called the a. orthocenter. b. centroid. c. base. d. altitude.

The population of mice in Alfred is given by P(t)=2654e7t, where t is in years since 1986. The rate of change of the population is given by the formula (2654)(

Which equation best describes this Velocity–Time graph?

Email is one of the major ways that we communicate in the workplace..what are some things that u should not do when it comes to email ettiquite in the workplace

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----