PVTPore PVTPore

19-02-2020
History

contestada

which of the following practices of ivan the great were inspired by byzantine culture?

Respuesta :

greninsmashboss greninsmashboss

19-02-2020

Answer:

becoming the head of the Russian Church

Explanation:

He was russian:/

Answer Link

Otras preguntas

will mark brainliest this is confusing, please show work

10. Which lines from the text might lead the reader to believe that Ponyboy feels like an outsider? A "No one in our gang digs movies the way I do." B "The gi

7. Which of these is part of the legislative branch of the United States government?a. the Cabinetb. the Presidentc. the Supreme Court d. the House of Represent

DNA makes up chromosomes which are found where in cell

How does a filter separate mixtures like sand and water?

Someone help me with this ASAP

Which is correct? A. serving on a jury is a responsibility B. serving on a jury is an obligation C. serving on a jury is voluntary

What is the slope of the line?

Use the restriction enzyme EcoRi to cut DNA Victim DNA : GGAAG ATTCTACATTACTGACGGACGTGACGTGA CCTTCTTAA GATGTAATGACTGCCTGCACTGACT Number of restriction fragmen

Brandon was the first runner out of the blocks. Is it a skill-related or health-related component?