farhanabadar86 farhanabadar86

19-03-2024
Biology

contestada

An mRNA codon for the amino acid Alenine is GCC. How many Alenine molecules are present in polypeptide containing 8 amino acid code for, the following DNA template
TCGGCCTACCGGGCCCATGCCAAT

Respuesta :

Otras preguntas

How do you turn decimals with whole numbers into fractions?

You have $1.00 in dimes and nickels. You have twice as many dimes as nickels. What would the associated system of equations look like in augmented matrix form

3/8 x 2/6 x 4/8 x 5/12

The ratio of money in Obi's wallet to Rudy's wallet one day was 5:2. Obi spent £20 that day. Obi now had £8 less than Rudy. How much did Obi initially have?

Which value represents a number that has a distance of 4 units from 0 on a number line A |-4| B square root of 4 C 0.4 D 1/4

some metabolic energy is releasedas heat. what happens to the Reston the rnergy

find the dimension of density

Find the distance between the points (2,8) and (-1, 9)

Beyond what point must an object be squeezed for it to be a black hole? A : Schwarzschild Radius. B : Crackpoint. C : Event Horizon. D : Hawking Boundary.

Plssss Help!! Determine the horizontal asymptote for the rational function. A rational function is graphed in the second quadrant, and in the first and thi